These libraries should be useful for application in a wide range of tissues and species. The host range has been expanded to previously uninfectable hosts [11], and infection of non-neural tissue with CHAPOL has been observed, as one would expect based upon experience with avian and murine retroviruses.

Proteinase K digestion: The coverslips were removed from slides by immersion in sterile H₂O. Single cells or small clusters of cells containing purple NBT precipitate with surrounding unlabeled tissue (approximately 0.5 to 2 mm tissue fragments) were scraped from the slide using a heat pulled glass micropipette (figure 2). The cells were transferred to a 96 well PCR (Hybaid) plate with 10 ml of a proteinase K solution (50 mM KCl, 10 mM TrisHCl pH 7.5, 2.5 mM MgCl, 0.02% tween 20, 200 mg/ml proteinase K). Each well was overlaid with 1 drop of light mineral oil (Sigma) and the plates were heated to 60°C for 2 hours, 85°C for 20 minutes, and 95°C for 10 minutes in a Hybaid OmniGene thermocycler.

Nested PCR: The first PCR was accomplished by adding 0.15 ml Taq polymerase (Boehringer Mannheim), 0.15 ml dNTP mix (Boehringer Mannheim), 0.75 ml each of 10 mM oligonucleotide 0 (5'TGTGGCTGCCTGCACCCCAGGAAAG3') and 10 mM oligonucleotide 5 (5'GTGTGCTGTCGAGCCGCCTTCAATG3'), 2 ml PCR buffer with MgC12 (Boehringer-Mannheim) and 16.2 ml of H20 to each well of the 10 ml proteinase K solution (final volume 30 ml). This was cycled at 93°C x 2.5 minutes; [(94°C x 45 seconds)(72°C x 2 minutes)] x 40 cycles; 72°C x 5 minutes.

The second PCR was performed with 1 ml of reaction product from the first PCR added to 0.25 ml Taq polymerase (Boehringer-Mannheim), 0.25 ml dNTP mix (Boehringer Mannheim), 1 ml each 10 mM oligonucleotide 2 (5'GCCACCACCTACAGCCCAGTGG3') and 10 mM oligonucleotide 3 (5'GAGAGAGTGCCGCGGTAATGGG3'), 2 ml PCR buffer with MgC12 (Boehringer Mannheim) and 14.5 ml of H20 (final volume 30 ml). The reaction was thermocycled at 93°C x 2.5 minutes; [(94°C x 45 seconds)(70°C x 2 minutes)] x 30 cycles; 72°C x 5 minutes. An aliquot of DNA was run on a 1.5% agarose gel (0.75% Seakem, 0.75% NuSeive) to insure that the appropriate insert was present (figure 3).

Sequencing: Sequencing was performed using the CyclistTM Exo- Pfu DNA sequencing kit from Stratagene. Briefly, 5 ml of each d/ddNTP mix was added to four wells on a 96 well Hybaid plate. To each of these wells 25% of the following mixture was added: 1 ml of the nested PCR product, 1 ml of 10 mM Oligo 3, 3 ml 10 x sequencing buffer, 1 ml Exo-Pfu, 0.75 ml 35S (10 mCi), 4 ml DMSO, and 11.25 ml H20. This was cycled at 95°C x 5 minutes; [(95°C x 30 seconds)(60°C x 30 seconds)(72°C x 1 minute)] x 30 cycles. Sequencing reactions were analyzed on a 6% acrylamide denaturing gel (figure 3).

1 ml 1/100 diluted DPL (0.6 mg/ml), l ml DPLP (0.44 mg/ml), 1 ml DPLP5 (0.2 mg/ml), 5 ml 2.5 mM dNTP mix, 10 ml 10 X PCR buffer (Boehringer-Mannheim), 79 ml water, 2 ml Taq DNA polymerase (Boehringer-Mannheim)

The product was phenol/chloroform extracted, ethanol precipitated, digested with AscI and XhoI, gel purified, and ethanol precipitated. Approximately 3 mg of AscI/XhoI digested BABE-AP-X was ligated to 25 ng of AscI/XhoI digested DPLl in a 100 ml ligation reaction at 16°C overnight. The product was phenol/chloroform extracted, ethanol precipitated, and resuspended in 50 ml TE. Twenty ml of ligation product was used to transform ElectroMax DHlOB (Gibco/BRL) competent cells according to the manufacturer's instructions. The transformed cells were pooled. One ml of the pooled cells was serially diluted and plated on LB/amp plates. The remainder of the pool was split into five 1-liter cultures of TB containing ampicillin and kanamycin sulfate (each at 50 mg/ml) and shaken overnight at 37°C. 3.7 mg of BOLAP plasmid was extracted from the overnight cultures by triton lysis, followed by purification via CsCl gradient. In the case of our preparation of BOLAP, the number of colonies on the LB/amp plates projected a total number of transformants to be 1.28 X 107. A control ligation containing no DPLl projected the background of vector without DPLl insert to be 0.9%.

To test the complexity of the library, the protocols of [46] were followed. One ml of viral supernatant was diluted into 30 ml DME with l0% calf serum. One to two ml of this diluted viral stock was used to infect a 30-50% confluent 6 cm dish of NIH3T3 cells. Five to six hours later, the infected cells were trypsinized, diluted ten fold, and plated on 96 well dishes. Three days later, the plates were washed with PBS, fixed with 4% paraformaldehyde for 10 minutes, washed thrice with PBS for 5 minutes, heated to 65°C for 25 minutes, and then stained overnight for AP activity with X-Phos and NBT. The following morning, each well was examined for the presence of a single discreet grouping of AP+ cells. The cells in chosen wells were washed with PBS. Ten ml of 400 mg/ml proteinase K solution (50 mM KCl, 10 mM Tris-HCl, pH 7.5, 2.5 mM MgCl2, 0.02% Tween-20) was added and the cells and solution were scraped/suctioned off and placed in individual wells in a 96 well dish. A drop of mineral oil placed over each well and the plate was heated to 65°C for 2 hrs, 85°C for 20 min, and 95°C for 10 min.

上一页  [1] [2] [3] [4] [5] [6] [7] [8] [9] [10] 下一页