Small RNA Markers for following miRNAs and siRNAs
(markers should be 5' end labeled and gel-purified after labeling).
24 bp marker (synthetic sequence from an RNA ligase ribozyme; underlined bases mark an Acl-I site)
44.12R: GGCCAACGUUCUCAACAAUAGUGA
18 bp marker (underlined bases mark a BamH-I site)
18.113R: AGCGUGUAGGGAUCCAAA

Other recommended special items to purchase:
³²P-γ-ATP (6000 ci/mmol)                                         T4 RNA Ligase
T4 Polynucleotide Kinase                                            Glycogen
Vertical electrophoresis unit for acrylamide gels         Superscript III Reverse Transcriptase
Siliconized Tubes                                                         Ban-I restriction enzyme
Aerosol Filter tips                                                        Metaphor GTG Agarose

• 5' End Label Marker RNAs
Kinase RNA markers to very high specific activity by the following pr℃edure:
1 μL of 1 μM RNA (44.12R or 18.113R)             Incubate for 1 hr at 37 ℃.

2 μL PNK Buffer                                                  Gel-purify labeled RNA on a 20% denaturing
1 μL PNK                                                             acrylamide gel, using glycogen as a carrier to
5 μL 6000 Ci/mmol ³²P γ-ATP (3μM)                precipitate after eluting from gel slice.
11 μL dH₂O

Resuspend each labeled RNA in 40 μL dH₂O. Run 2 ul on a test acrylamide gel and wrap the wet test acrylamide gel. Expose to phosphorimage plate and see if you detect a strong signal after a 5 minute exposure. Generally, 3000 counts of labeled RNA is a good starting point to test. The goal is to determine the minimum amount of labeled RNA to add to your total RNA during the purification step of 18-26-mers. Minimizing the addition of marker RNAs will maximize the number of miRNA/siRNA clones in the final step.

• Purifying 18-26mers from Total RNA
Pour a 15% 1.5 mm denaturing polyacrylamide gel with wide wells (23mm). Prerun to warm up gel. Make sure the lane is quite flat for nice loading and resolution of markers.
Prepare an aliquot of total RNA (50-500 μg), adding trace but very high specific activity radiolabeled marker RNA and 1X volume of 8M Urea, 0.5 mM EDTA Loading Dye. Heat for 5min in 80o C heatbl℃k and load entire volume in one lane. Electrophorese until the BB dye reaches the bottom. Expose gel, cut out gel slice that includes both top and bottom hot markers. Elute RNAs O/N in 0.3M NaCl, precipitate in 2X volume EtOH (>2 hrs) with glycogen (1 μg/ ml). Spin down (full speed, 30 min) and resuspend in 10 μl dH₂O.
A Note on Total RNAs: not all total RNA sources, particularly commercial total RNA sources, may contain small RNAs like miRNAs and siRNAs! If a sample of “total” RNA was purified by the popular silica matrix column pr℃edure (i.e. Qiagen RNEasy columns), it will be significantly depleted in small RNAs. Extraction pr℃edures like Trizol/TriReagent, however will purify all RNAs, large and small, and are the recommend methods for isolating total RNA from biological samples that will contain miRNAs/siRNAs.

上一页  [1] [2] [3] [4] [5] [6] 下一页