III. Riboprobe synthesis (Recommended for Northerns)
1. Solutions:10X NTP mixture:
10 mM ATP
10 mM CTP
10 mM GTP
6.5 mM UTP
3.5 mM DIG-UTP
2. Reaction:
a. Add the following reagents in order on ice:
*Purified template (1 µg) + dH2O in 13 µl
10X NTP mix 2 µl
10X Transcription buffer 2 µl
RNase inhibitor 1 µl
RNA polymerase (SP6, T3 or T7) 2 µl
*Purified template can be from a variety of sources:
1. Vectors: To avoid transcription of undesirable sequences from a linearized vector, cut vector with enzyme which leaves 5' overhangs or blunt ends, then gel purify.
2. PCR products: One can design PCR primers that include either a T3 or T7 promoter in the 5' end of the primer. Simply run the PCR and then gel purify fragment.
For T3: ATCGAAATTAACCCTCACTAAAGGG
For T7: ATCGATAATACGACTCACTATAGGG
b. Incubate for 2 hours at 37 deg C.
c. Add 2 µl DNase I and incubate 15 minutes at 37 deg C.
d. Add 2 µl 0.2 M EDTA to stop reaction
e. Purify on G-50
End-labeling Ladder
1. On ice mix:32 µl sample (10 µg 1kb ladder (BRL) + H2O
5 µl 10x TMD (500 mM Tris-Cl pH 7.5, 100 mM MgCl2, 100 mM DTT)
1 µl dig-UTP (alkali-stable; B-Mann cat. #1093088 or 1558706)
2 µl T4 DNA Polymerase (1u/µl)
2. Incubate 5' at 37 deg C.
3. On ice add:
5 µl 1 mM dATP,dGTP
5 µl 1 mM dCTP
4. Incubate 15' at 30 deg C.
5. Add 6 µl stop solution (2% Sarkosyl 0.4 M EDTA pH 8.0).
6. Purify on G-50 spin column.
