2.Identify the sequence using BLAST search (Staden).
The Basic Local Alignment Search Tool (BLAST) finds regions of local similarity between sequences. The program compares nucleotide or protein sequences to sequence databases and calculates the statistical significance of matches. BLAST can be used to infer functional and evolutionary relationships between sequences as well as help identify members of gene families.
-To launch internet browser and follow to the NCBI blast program web interface follow this link http://www.ncbi.nlm.nih.gov/BLAST/
-Select the Nucleotide-nucleotide BLAST (blastn) link to do nucleotide search. When doing an amino acid query choose blastp.
-Copy and paste your contig sequence into the Search box.
-Options include a number of different sequence databases that can be searched using blastn. The default database is nr, which is the collection of all unique sequences. It contains all non redundant Genbank CDS translations + PDB + SwissProt + PIR +PRF entries. The nr database is a good choice for a comprehensive search. More information on the BLAST databases is available at http://www.ncbi.nlm.nih.gov/blast/blast_databases.shtml.
-After you submit your query, you will be taken to the formatting BLAST page.
-The formatting BLAST page also provides options for changing the format of BLAST results.
Since we are not changing any format options, click on the
button on the formatting BLAST page, and a new browser window will open that contains the BLAST results. It may take a few minutes to generate the BLAST Results page. -The BLAST Results page includes a unique request ID (RID), query information, database information, a link to taxonomy reports, a graphical display showing alignments to the query sequence, descriptions of sequences producing significant alignments, and pairwise alignments between the query sequence and each BLAST hit sequence.
-Identify the best match, percent sequence identity with the query. How many gaps were inserted in the pairwise alignment?
3.Design and verify primers in silico (FastPCR).
Launch the FastPCR program and select “Running PCR from the left side menu.
Paste the sample sequence given below
>sample
TGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTCTAAGTATAAACCATTTATAC
AGGTGAAACTGCGAATGGCTCATTAAATCAGTTATAATTTATTTGATAGTACAATTACTAC
TTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAATTCCCGACTTCTGGAAGGGA
TGTATTTATTAGATAAAAAACCAATATCGGGAAACCGATTCTCATGGTGATTCATAATAAC
TTTTCGAATCGCACGACTTTACGTCGGCGATGAATCATTCAAATTTCTGCCCTATCAACTT
TCGATGGTAGGATAGAGGCCTACCATGGTGGTAACGGGTAACGGGGTGTTAGGGCACGACA
CCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGATGGCAGCAGGCGCGCAAATTA
CCCAATCCCGACACGGGGAGGTAGTGACAATAAATAACAATACGGGGTTCTTTAGGATTTC
GTAATTGGAATGAGTACAATTTAAATCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGT
GCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGCTGCAGTTAAAAAG
CTCGTAGTTGAATTTCGGGACCATCACGTCGGTCGTGCCTCGGTACGTACTGGCGTCGTTG
GTTTCTCCCTTCTGACGAACCATGATGTCATTTATTTGGTGTCGTGGGGAATCAGGACTGT
TACTTTGAAAAAATTAGAGTGTTTAAAGCAGGCTCACGCTTGAATACATTAGCATGGAATA
ATGAAATAGGACGTTTGATTCTATTTTGTTGGTTTCTAGGATCGACGTAATGATTAATAGG
GATAGTTGGGGGCATTAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACT
AACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAAGAACGAAAGTTAGGGGAT
CGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGATG
ATGTTAATTTTTTAATGACTCATTCGGCGCCTTACGGGAAACCAAAGTGTTTGGGTTCCGG
GGGGAGTATGGTCGCAAGGCTG
To design primers using FastPCR it’s necessary to specify the positions for primers to be designed.
All the specifications have to be placed in the header line of fasta definition.
Thus to design a left primer in position 500 to 550 and right primer between position 1000 and 1080 the fasta header definition line will contain the following command:
>sample -lpd500-560 -rpd1000-1080
where lpd and rpd stands for left and right primer design. To learn about other options available for primer design refer to help page. 
To verify the designed primers select In silico PCR in the left menu. Copy and paste primer sequences and select Run (use your primers and/or primers that were used to amplify the DNA fragment for sequencing during your previous lab).
>NS31
TTGGAGGGCAAGTCTGGTGCC
>AM1
GTTTCCCGTAAGGCGCCGAA
Identify the primer positions along the fragment, annealing temperature and PCR product size.
